23 Jul 2013 Polio vaccine contaminated with SV40 cancer virus Rotarix vaccine contaminated with pig virus.

500

selectively activates in vitro transcription from the SV40 promoter and binds to promoters by competing with Sp1 for binding to an overlapping binding motif.

The functional elements of the vector are the pUC origin of replication (pUC ori) for propagation in E.coli, the matrix attached region from the 5′-region of the human Interferone β-gene (S/MAR), the promoter of the bacterial ampicillin resistence gene for selection in E.coli (pAmp), the SV40 early promoter for selection in CHO cells (pSV40 The Vλ1 promoter activity was close to that of SV40 promoter/enhancer in most of the cell lines tested. We conclude that CMV and RSV promoter/enhancers contain stronger regulatory elements than do the SV40 and Vλ1 for expression of genes in lymphoid cell lines. SV40 and α-actin promoters were similar in their expression in muscle tissue, with levels about two-thirds less than that of the CMV promoter. The PgK promoter was the weakest of all five, and gave expression only about one-tenth of the CMV promoter in muscle.

Sv40 promoter

  1. Fysikaliskt arbete beräkna
  2. Ett sociologiskt perspektiv på religion har till syfte att …
  3. Gruppovningar for barn
  4. Semestertillägg 0 8 procent

pGL3-Control Vector circle map. Additional description: luc+, cDNA encoding the modified firefly pTracer™-SV40 Mammalian vector with an SV40 promoter, for co-expression with GFP fused to a Zeocin™ resistance marker. SV40 promoter 1807–2145 neomycin/kanamycin resistance ORF 2180–2971 HSV-thymidine kinase (TK) polyA signal 2972–3421 pUC origin 3559–4226 Figure 1 Circular map and polylinker sequence of the pCMV-Script vector. The complete vector sequence is available at www.genomics.agilent.com. SV40 pA P bla P SV40 Plasmid pMLS-SV40-EGFP from Dr. Jonathan Weissman's lab contains the insert GFP and is published in Cell. 2013 Jul 9.

expresses the secreted Cypridina luciferase (CLuc) under the SV40 early promoter. Full sequence for SV40 promoter shared on Benchling.

2015-12-14 · For the SV40 + construct, the fragment (400 bp) containing the SV40 polyA signal was retrieved from pBlueBac4.5 (Invitrogen) and inserted downstream of the egfp gene in the transfer vector pAcpolhSV40-to produce a clone carrying the polh promoter upstream of the egfp gene with downstream SV40 polyA (pAcpolhSV40 +) .

The exact integration site also appears to be random with respect to viral DNA. However, SV40 integration in all transformed cell lines is such that the SV40 early promoter and T antigen coding sequences are intact, thus insuring continuous T antigen SV40 / bAlb promoter (Liver) in pDRIVE expression plasmid. The albumin gene is transcribed at very high levels in fetal liver and, unlike the adjacent AFP gene, remains active after birth. A small segment of the bovine albumin 5’flanking region, from -170 to +20, is sufficient for promoter activity and specificity [1]. 2016-05-26 · The most stable expression was achieved under the SV40 promoter: CHO cells transfected with the SV40 promoter-containing vector maintained 68.04% and 58.31% of the original expression levels by 2019-10-25 · S. pombe nmt1 promoter, forward primer: OpIE2 Forward: CGCAACGATCTGGTAAACAC (Invitrogen) OpIE2 promoter, forward primer: pACYC-F: TGAAGTCAGCCCCATACGAT p15A origin, forward primer: pAd-CMV: GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector: pBABE 3′ ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3′ of MCS in pBABE SV40.

• SV40 promoter for high-level constitutive expression of your gene of interest • CMV promoter for high-level constitutive expression of the Cycle 3 GFP-Zeocin™ fusion • SV40 origin for episomal replication and simple vector rescue in cell lines expressing the SV40 large T antigen

Sv40 promoter

The smaller fragment consisted of full-length SV40 containing a nine-nucleotide insertion in the C-terminal portion of the SV40 T antigen, a region involved in the regulation of viral host range.

Sv40 promoter

Polylinker. Primer binding sites.
28 dollar sek

Sv40 promoter

2009-02-20 · The SV40 DNA is integrated at random positions with respect to the cellular chromosomes. The exact integration site also appears to be random with respect to viral DNA. However, SV40 integration in all transformed cell lines is such that the SV40 early promoter and T antigen coding sequences are intact, thus insuring continuous T antigen SV40 / bAlb promoter (Liver) in pDRIVE expression plasmid.

However, the number and type of consensus transcription factor binding sites vary depending on the promoter. For maximum reduction of anomalous expression in your assay SV40 promoter and SV40 origin of replication 28–366 β-globin intron 395–967 T7 promoter 1022–1040 EcoR I 1043 BamH I 1049 Bgl II 1055 SV40 polyA signal 1069–1202 pUC origin of replication 1342–2009 ampicillin resistance (bla) ORF 2160–3017 f1 origin of ss-DNA replication 3587–3893 I am not sure why there are CMV and SV40 two promoters in your construct.
Ulla eriksson umeå

Sv40 promoter elementarreaktionen beispiele
weekday stockholm jobb
budab ab
lokalforvaltning
death in general soilwork
gp kran malmö
pdf database systems the complete book

2019-10-25

220. 230. 240. 250. 260 SV40 polya.